PDF Cahier des charges de la -Cahier des charges HPS - L'actualité de la pédagogie Académie de - cahier du bac
Wait Loading...


PDF :1 PDF :2 PDF :3 PDF :4 PDF :5 PDF :6 PDF :7 PDF :8 PDF :9


Like and share and download

cahier du bac

Cahier des charges HPS - L'actualité de la pédagogie Académie de

Cahier des charges conception de la démarche pédagogique Bac professionnel 3 ans Ac Bordeaux – Gr de pilotage académique bac pro CSR Cuisine 5 juin 2018 2 cahiers format A4 – 96 pages petits carreaux compas, équerre, rapporteur copies doubles A4 petits

Related PDF

Cahier des charges de la conception de la démarche pédagogique

Cahier des charges conception de la démarche pédagogique Bac professionnel 3 ans Ac Bordeaux – Gr de pilotage académique bac pro CSR Cuisine
PDF

Liste des fournitures scolaires et d'atelier BAC MAINTENANCE

5 juin 2018 2 cahiers format A4 – 96 pages petits carreaux compas, équerre, rapporteur copies doubles A4 petits carreaux Calculatrice TI 82 advanced
PDF

Liste des fournitures scolaires et professionnelles – BAC LOGISTIQUE

Seconde Bac logistique Première Bac logistique Terminale Bac logistique MATHS SCIENCES 1 cahier format A4 – 96 pages petits carreaux compas, équerre 
PDF

ressources pour les ccf - rnrsms

Cahier des charges académiques des CCF CLERMONT FERRAND Bac Professionnel ASSP Cahier des charges (ressources nationales et académiques )
PDF

cahier des charges CCF bac pro ASSP option D et S - SBSSA - Lyon

Académie de Lyon BAC ASSP option « à domicile » et option « en structure » Cahier des charges à la mise en œuvre du CCF 2018 1 Ce document a pour 
PDF

CORRIGE DU CAHIER D'HISTOIRE NIVEAU 1 bac pro

Mars 2016 CORRIGE DU CAHIER D'HISTOIRE NIVEAU 1 ère bac pro LA FRANCE PENDANT LA SECONDE GUERRE MONDIALE DE L'ÉTAT FRANÇAIS A 
PDF

cahier de bord pour la realisation de l'u32 - SBSSA Versailles

Bac Professionnel SPVL Page 2 A RAPEAUD octobre 2010 2 Quelques conseils L'objectif de ce cahier de bord est de vous aider dans la préparation et la 
PDF

liste de fournitures scolaires MEI 2018

Livre (commun aux 3 années du Bac Pro) Guide du TOP'FICHES Bac Pro Maintenance des Équipements industriels Ed Foucher « les nouveaux cahiers »
PDF

Cahier des charges HPS - L'actualité de la pédagogie Académie de

Cahier des charges Bac Pro H P S Académie de Nancy Metz 1 13 arrêté du 17 juillet 2012 Règlement d'examen des épreuves professionnelles E31 à E33 
PDF

cahier exercices maths 5eme

PDF 4 - Hachette Education

PDF évaluation nationale des acquis des élèves en 5 media eduscol cache media eduscol education Cahier eleve eval nale 5 maths 2012 215462 pdf PDF Mathematiques, 5e Cahier d'exercices Telecharger, Lire PDF hartwoolbdenape firebaseapp 2040193669

Cahier Meca 4 ST

Expérience gourmande sur le Chemin du Terroir

acdenis files wordpress 2015 06 obs4 ste ch 4 Nomme la contrainte subie par chacun des objets soulignés dans les énoncés suivants a) Un conducteur serre le bouchon du réservoir à essence de son véhicule après avoir fait le plein Torsion b) Une cuisinière déchire des

Cahier3e

MIPCOME Manual Book Reference And Ebook

historicaltexts Rev (1789) Cahier (Carcassonne 3e) pdf 60 The third estate of the district of Carcassonne places its trust, for the rest, in the zeal, patriotism, honor, and probity of its deputies in the National Assembly in all matters which may accord with the beneficent

Cahiers d´exercises rond point 1

Description READ DOWNLOAD

ww1 neptunesvilla 651997 Nouveau Rond Point Bd 1 Nouveau Rond Point Bd 1 Cahier d'activités, m Audio CD Summary Agirc Arrco Retraite complémentaire des salariés du secteur privé FAQ Vous êtes en activité · Vous êtes proche JE M'INFORME SUR MES DROITS DSN descargartexto

Cahiers De Nutrition Et De Diététique

Biologie Microbiologie cahiers NOUVEAUX

sraenutrition files 00 01 67 00016766 3056abfa4d Cahiers de nutrition et de diététique (2011) 46, 178—186 DIÉTÉTIQUE Quel soin diététique dans le cadre de la chirurgie bariatrique? Recommandations de pratique clinique What dietetic care for bariatric surgery? Guidelines for clinical practice Richard Agnetti∗, 1, Pauline Chenebault , Céline Coelho,

Cahiers du cinema No 67

André Bazin, the Critic as Thinker - Springer

nyu edu projects cinema resources exam bib NYU DEPARTMENT OF CINEMA STUDIES Theory of Image and Sound (updated 2 14 2013) Cahiers du Cinema 1969 72 The Politics of Representation What is Cinema umabroad umn edu assets files Syllabi Montpellier

cahiers exercices 4eme maths

Correction Sesamath 3eme

Composé d'une série non exhaustive d'exercices, il doit permettre à chaque élève de mettre à jour ses Le professeur Matheux a lancé un défi à ses élèves de 4ème « L'élève qui trouve le plus Exercice 3 (Extrait Mon cahier

  1. Epreuve Commune de 4ème
  2. Maths.ac-Bordeaux
  3. corrigés du cahier d
  4. exercices
  5. Corrigés des exercices du livre élève
  6. Cahier de révision 4ème maths
  7. livret cours et exercices auto-corrigés
  8. Cahier d
  9. exercices de mathématiques pour les métiers
  10. Liste fournitures 4eme 2018-2019.pdf

Cahuzac Arlequin

Katedra strunových a dychových nástrojov HTF VŠMU Požiadavky

digital library unt edu ark 67531 metadc278517 Cahuzac's Early Years As a Student and As An Orchestral Musician 8 Cahuzac As a Solo Performer and Recording Artist 11 Cahuzac As a Conductor 15 Cahuzac As a Teacher 17 Cahuzac's Legacy in Music 20 III EXAMINATION OF

Cahuzac - Cantilene

John Coppa, clarinet John Coppa, clarinet - LSU School of Music

PDF Alo, V LOUIS CAHUZAC'S CLARINET MUSIC UNT Digital Library digital library unt edu ark d 1002720103 sanders pdf PDF Program Notes Amazon S3 s3 amazonaws data Intermezzo

Home back Next

Description

‫وزارة التربية والتكوين‬ ‫بجندوبة‬  ‫الدارة الجهوية للتعليم‬

‫المركز الجهوي للتربية والتكوين المستمر بجندوبة‬

Exercices corrigés

Kamel Hmissi Sadok Bouzazi Ridha Ben Hmida Noura Kaabi Taoufik Rouaissi Hedi Arfaoui Jalel Assistance de: Mr Maâlmi Lazaâr (Inspecteur des sciences naturelles)

Cahier n°1 : Reproduction humaine Génétique

Septembre 2005

Avant-propos Ce modeste ouvrage est le fruit d’un effort collectif d’un groupe de professeurs de la région de Jendouba

Le présent cahier est destiné aux élèves de la 4ème sciences expérimentales et comporte un ensemble d’exercices et de sujets de synthèse avec des corrigés détaillés se rapportant aux deux premiers chapitres

L’élève est appelé à tirer profit de ce manuel en s’exerçant aux questions et problèmes proposés mais aussi d’examiner attentivement ensuite les corrigés

Nos chers élèves ainsi que nos aimables collègues sont priés d’adresser tous leurs remarques et critiques selon deux voies : • Par voie postale ou par téléphone au CREFOC de Jendouba • Par e

Les auteurs

Première partie : 

Fonction de reproduction chez l’homme Fonction de reproduction chez la femme

EXERCICE 1 : QCM

Pour chacune des questions suivantes,

il peut y avoir plus qu’une réponse exacte

Reporter le numéro de chaque question et indiquer la (ou les) lettre(s) correspondant à la (ou aux) réponse(s) exacte(s)

Les tubes séminifères Les cellules de Sertoli Les cellules interstitielles L’hypothalamus

Permet la mobilité du gamète mâle Renferme un noyau diploïde Pénètre dans l’ovocyte lors de la fécondation Renferme un noyau haploïde

De grande taille Présente dans le sperme Fabriquée par la prostate Mobile

Une diminution de la sécrétion de LH Une augmentation de la sécrétion de LH Une diminution des pulses de GnRH L’atrophie du tractus génital

Entretient les caractères sexuels primaires et secondaires mâles Est sécrétée à taux constant par les cellules de Leydig Intervient dans la spermatogenèse Exerce une rétroaction sur le complexe hypothalamo-hypophysaire

Une augmentation du taux de LH et une diminution de celui de FSH Une diminution du taux de LH et une augmentation de celui de FSH Une diminution du taux de LH et de FSH Une augmentation du taux de LH et de FSH

Diploïde et chaque chromosome comporte deux chromatides Diploïde et chaque chromosome comporte une chromatide Haploïde et chaque chromosome comporte deux chromatides Haploïde et chaque chromosome comporte une chromatide

le nombre de spermatozoïdes obtenu est : abcd-

Le double du nombre de spermatocytes I Egal au nombre de spermatides Quatre fois le nombre de spermatocytes I Egal au nombre des spermatides I

Tube séminifère —› canal déférent —› urètre Epididyme —› canal déférent —› urètre Tube séminifère —› canal déférent —› urètre Tube séminifère —› épididyme —› spermiducte —› urètre

Le corps jaune La thèque interne du follicule L’hypophyse L’hypothalamus

Contrôlent directement le développement de l’utérus Contrôlent directement le fonctionnement de l’ovaire Contrôlent indirectement le développement de l’utérus Sont soumises à une rétroaction par les hormones ovariennes

2O- La croissance d’un follicule ovarien est contrôlée par : a- La LH b- La FSH c- Les oestrogènes d- La progestérone

l’émission du deuxième globule polaire se fait: a- Avant la fécondation b- Au moment de la fécondation c- Dans l’endomètre d- Dans l’ovaire

le placenta: a- Secrète la HCG b- Secrète la FSH c- Secrète la LH d- Secrète l’oestradiol et la progestérone

EXERCICE 2 :

Résumez à l’aide d’un schéma fonctionnel,

les mécanismes de contrôle et de régulation des fonctions testiculaires chez l’homme

EXERCICE 3 : Le document 1 représente le schéma d’une portion de coupe dans un organe de l’appareil génital chez la femme

Document 1

Document 2

1°a- Identifiez l’organe observé et complétez la légende correspondante en reportant les numéros (1 à 5) et les lettres (A,

D et E) sur votre copie

b- Précisez à quelle phase du cycle sexuel,

cette coupe a été réalisée

? 2°- Le document 2 est une photographie de la structure A (doc

a- Faites un schéma annoté de l’élément représenté par cette photographie b- Indiquez les différences entre l’élément A du document 1 et celui du document 2

représentez à l’aide de schémas simples,

l’état des chromosomes au cours de l’anaphase I et de l’anaphase II de la méiose

EXERCICE 4 : Le document 1 représente schématiquement une coupe partielle au niveau d’un testicule humain

Document 1

1°-indiquez sur votre copie la légende correspondante aux numéros figurant sur le schéma du document 1

b et c'sur le document 1 sont en cours de division

En vous basant sur le processus qui se déroule au niveau de la région A : a- Précisez la phase et le type de division pour chaque cellule b- En simplifiant le nombre de chromosomes à 2n = 4,

faites un schéma d’interprétation bien soigné et légendé de chacune des cellules a,

on vous demande deux expériences et leurs résultats : • Une qui montre le rôle de cette région • une qui montre sa voie d’action

EXERCICE 5 : Les figures du document 1 illustrent quelques étapes d’un phénomène biologique important qui se déroule dans l’appareil génital de la femme

1°-Identifier et définir ce phénomène biologique

les étapes représentées par ces figures

n°8 et n°9

Document 2

donnez les différentes combinaisons chromosomiques possibles dans chacun des éléments n°5 et n°7,

en justifiant la réponse à l’aide de schémas simples et clairs

b- Quel serait alors le nombre de combinaisons théoriquement possibles dans la structure issue des éléments n°5 et n°7

EXERCICE 6: Les figures du document 1 illustrent des observations microscopiques de structures cellulaires prélevées au niveau des oviductes chez un lot de lapines après accouplement

Document 1

1°- Définissez brièvement le phénomène représenté par les figures du document 1

les étapes représentées par les figures du document 1

EXERCICE 7: Pour étudier le déterminisme hormonal du cycle sexuel chez la femme,

des expériences ont été réalisées chez la guenon (femelle de singe) dont le cycle sexuel est semblable à celui de la femme

On soumit cette guenon à une série d’expériences : 1ère série d’expériences : Expériences 1- Stimulation électrique de certains noyaux de l’hypothalamus

Résultats Elévation du taux sanguin des gonadotrophines (FSH et LH) hypophysaires Chute du taux sanguin de LH et de FSH Augmentation du taux de FSH et de LH

1°- Interprétez les résultats de ces expériences

? 2ère série d’expériences :  A l’instant T0 : on fait l’ablation des deux ovaires

 A l’instant T1 : on fait une perfusion continue d’œstradiol qui maintient le taux sanguin à

 A l’instant T2 : on injecte une dose d’œstradiol de l’ordre de 600 pg

 A l’instant T3 : on injecte une faible dose d’œstradiol et de progestérone

On dose à chaque fois le taux plasmatique d’une hormone hypophysaire (LH)

Les résultats sont consignés dans les graphiques suivants

1°- Analysez les courbes du document 3 en mettant en relation les variations du taux des hormones ovariennes et hypophysaires 2°- En déduire le principe de la contraception hormonale (pilule combinée)

dressez un schéma fonctionnel illustrant le déterminisme hormonal de l’ovulation

EXERCICE 8: Trois types d’hormones jouent un rôle important au cours de la grossesse chez la femme

A fin de préciser le rôle de ces hormones,

on réalise les expériences suivantes : • Expérience 1 : Chez la femme enceinte,

En revanche,

si l’intervention est effectuée plus tard,

elle n’a pas d’influence majeure sur la grossesse qui se poursuit normalement

• Expérience 2 : Chez une femme sui n’est pas enceinte,

l’injection d’une hormone,

pendant 10 jours en phase lutéale entraîne le maintient du corps jaune et le taux des hormones ovariennes est comparable à celui observé au cours d’une grossesse

Document 2

Interprétez ces deux expériences en précisant les structures responsables de la sécrétion de ces hormones au cours de la grossesse tout en vous aidant du document 2

EXERCICE 9 : Chez la femme,

au cours de la phase pré ovulatoire,

la concentration plasmatique d’oestradiol augmente

EXERCICE 10 : On se propose de déterminer le mode d’action des pilules contraceptives combinées,

à partir de certains résultats expérimentaux et des acquis

Les graphes A et B suivantes montrent l’évolution du taux sanguin d’hormones ovariennes naturelles et de l’hormone lutéinisante (LH) au cours d’un cycle sexuel chez une femme qui prend des pilules combinées,

par référence à une femme qui ne prend pas de pilules

1°- Faites une analyse comparative des deux cas de figures A et B

EXERCICE 11 : Les deux figures du document 1 représentent 2 cellules germinales chez la souris à la fin de prophase I pour lesquelles on a simplifié la formule chromosomique à 2n = 4 chromosomes

Document 1 1°- A l’aide de schémas simples,

représentez pour chaque cellule l’anaphase de la 1ère division et l’anaphase de la 2ème division de la méiose (en envisageant tous les cas possibles)

dressez un tableau illustrant les différents types de gamètes ainsi que les zygotes qui peuvent résulter de leurs rencontres

le nombre de chromosomes est 2n = 8

Calculez le nombre de gamètes possibles puis le nombre de combinaisons possibles de zygotes

? EXERCICE 12 :(non corrigé) La créatinine est une substance qui provient de la dégradation des protéines et qui est éliminée dans les urines de la femme

Des dosages réguliers du taux de créatinine ont été effectués chez trois femmes X,

Les valeurs obtenues en UI (unités internationales),

sont données par le tableau suivant Jours

1°- Représentez ces valeurs sur le même système d’axes

? 3°- Déduire et expliquez l’état physiologique de chacune des trois femmes X,

Deuxième partie : Génétique des diploïdes Génétique moléculaire Génétique humaine

Génétique des diploïdes

EXERCICE 1 : QCM

Pour chacune des questions suivantes,

il peut y avoir plus qu’une réponse exacte

Reporter le numéro de chaque question et indiquer la (ou les) lettre(s) correspondant à la (ou aux) réponse(s) exacte(s)

une redistribution des allèles un brassage de l’information génétique une diversité génétique la formation que de gamètes recombinés

échange de fragments de chromatides homologues brassage inter chromosomique brassage intra chromosomique ne se déroule pas chez le mâle de la drosophile

est porté par un chromosome X est porté par un chromosome Y est porté par un chromosome non sexuel est porté par les deux chromosomes X et Y

la F2 est toujours du type 9,3,

¼ et¼ la F2 du type ¾,

¼ le test- cross du type ½,

entre un individu de phénotype connu avec un testeur récessif entre un individu de phénotype inconnu avec un testeur récessif entre un individu de génotype inconnu avec un testeur récessif entre un individu de génotype inconnu avec un testeur récessif

tous les garçons seront atteints toutes les filles seront atteintes l’anomalie est indifférente au sexe un enfant atteint doit avoir au moins un parent atteint

b- un couple normal ne donne jamais des enfants malades

c- le mariage consanguin augmente le risque d’apparition de cette maladie

d- est plus fréquente chez les filles que les garçons

la maladie touche seulement les garçons la maladie touche les filles plus que les garçons un garçon atteint doit avoir un père atteint une fille atteinte doit avoir une mère atteinte

EXERCICE 2 :

A- On croise une drosophile femelle de type sauvage aux ailes longues et au corps gris avec une drosophile mâle aux ailes vestigiales et au corps ébène

On a obtenu en 1ère génération 182 drosophiles aux ailes longues et au corps gris

On a croisé ensuite des drosophiles femelles obtenues en F1 avec des drosophiles mâles aux ailes vestigiales et aux corps ébènes

Les résultats sont les suivants : 492 drosophiles aux ailes longues et corps gris 509 drosophiles aux ailes longues et corps ébènes 515 drosophiles aux ailes vestigiales et corps gris 487 drosophiles aux ailes vestigiales et corps ébènes A partir de l’analyse de ces résultats et des lois de Mendel,

proposez une hypothèse explicative de ces croisements

B- On croise des drosophiles de races pures,

les unes aux ailes longues et aux yeux rouge sombre (Yeux normaux),

les autres aux ailes vestigiales et aux yeux pourpres

Les individus de F1 ont tous des ailes longues et yeux normaux

On croise alors des femelles de F1 avec des mâles aux ailes vestigiales et yeux pourpres

On obtient : 1339 drosophiles aux ailes longues et yeux normaux 1195 drosophiles aux ailes vestigiales et yeux pourpres 151 drosophiles aux ailes longues et yeux pourpres 154 drosophiles aux ailes vestigiales et yeux normaux 1°- À partir de l’analyse de ces résultats,

proposez une hypothèse qui explique ces croisements

dressez une carte factorielle des gènes responsables des caractères étudiés dans cet exercice

EXERCICE 3:

On croise une chatte noire de race pure avec un chat orange de race pure

On obtient en F1 : 50% de chats tous de couleur noire et 50% de chattes bicolores (noire et orange)

On obtient en F2,

sur plusieurs portées : 20 chattes de couleur noire 22 chattes bicolores 19 chats de couleur noire 21 chats de couleur orange 1°- interprétez ces résultats et étudiez la descendance de F1 et F2

EXERCICE 4: On dispose de deux variétés pures d’une plante alimentaire : l’une à graines brunes et riches en amidon,

l’autre à graines blanches et riches en sucre

Le croisement de ces deux variétés donne une F1 où tous les individus ont des graines brunes et riches en amidon

? 2°- On croise ensuite un individu de variété à graines brunes et riches en amidon avec un individu à graines blanches et riches en sucre

On obtient les résultats suivants :  758 graines brunes riches en amidon  66 graines brunes riches en sucre  62 graines blanches riches en amidon  714 graines blanches riches en sucre a- De quel type de croisement s’agit- il

b- Interprétez génétiquement les résultats de ce croisement tout en écrivant les génotypes des parents et des descendants

c- Précisez la localisation chromosomique des gènes en question

a- Quel croisement doit-on réaliser

? b- Quelle proportion d’individus ayant le phénotype graines brunes riches en sucre obtiendra t- on

? c- Quelle proportion d’individus recherchés peut – on prévoir

EXERCICE 5:

Des souris à poils gris et lisses sont croisées avec d’autres à poils blancs et crépus

La F1 obtenue comporte des animaux tous au pelage gris et lisse

L’autofécondation de la F1 donne une F2 qui comporte 211 souris à poils gris et lisses et 69 souris à poils blancs et crépus

? 2°- Vérifiez alors génétiquement et statistiquement les résultats des 2 croisements

EXERCICE 6:

On croise deux variétés pures de tomate : l’une de taille normale à feuilles entières,

l’autre naine (taille petite) et à feuilles découpées

Les plants obtenus en première génération F 1 sont tous de taille normale et à feuilles découpées

En 2éme génération F2,

Justifiez la réponse

Justifiez les réponses

l’autre (B) de taille normale à feuilles entières

On obtient :

Indiquez les génotypes des plants (A) et (B)

Justifiez et vérifiez la réponse proposée

deux autres plants provenant également de la deuxième génération F2,

à feuille entière l’autre (D),

On obtient :

Indiquez les génotypes des plants (C) et (D)

Justifiez et vérifier la réponse proposée

EXERCICE 7:

La F1 obtenue est composée de plantes toutes à corolle rose et ouverte

? 2/ Donnez alors l’interprétation chromosomique et statistique des deux résultats

EXERCICE 8:

On s’intéresse à l’étude de la transmission de la couleur du pelage chez l’espèce Chat

Pour cela on a rassemblé les données suivantes :

B- Les chattes de phénotype « bigarré» (bicolore) sont toujours hétérozygotes alors que celles de phénotype «Noir» ou de phénotype «Orange » sont toujours homozygotes

C- Le phénotype « bigarré » ne se manifeste jamais chez les chats

Questions : 1/ Quels renseignements tirez vous à partir des données A et B

? 2/ Montrez que ces renseignements sont confirmées par la donnée C

b) Du croisement ♂ oronge avec ♀ Noir

Génétique moléculaire

EXERCICE 1:

Le phénotype est l’expression d’une information génétique localisée au niveau de l’ADN

Les hématies de l’homme n’ont pas de noyau lorsqu’elles se trouvent dans le sang

Elles proviennent d’érythroblastes : cellules nucléées,

se transforment en hématies énucléées

Les érythroblastes énucléés réalisent la synthèse de l’hémoglobine,

une protéine qui s’accumule dans le cytoplasme

Après la perte du noyau,

à fabriquer la protéine puis la synthèse cesse

Dans les hématies il n’y a pas du tout de synthèse de l’hémoglobine

? 2°- On représente ci-dessous un fragment du brin transcrit de l’ADN codant pour la synthèse de l’hémoglobine humaine Sens de lecture

TGAGGTCTTCTT………

ATC Nucléotide en position 3 a- Donnez la séquence de l’ARNm obtenue b- Retrouvez,

en utilisant le code génétique,

la séquence des acides aminés codée par le gène

Etape A : …………………………………

Etape B : ………………………

Etape C : ……………………………………

Etape D': ……………………………………

? e- Quelle propriété du code génétique ce résultat met-il en évidence

? f- Suite à une mutation génique par addition de nucléotide,

la séquence peptidique est devenue la suivante : NH2 – Thr –Pro COOH Donnez le fragment de l’ADN transcrit muté

Justifiez la réponse

EXERCICE 2 :

On connaît chez une variété de blé,

un champignon (R) qui s’attaque aux graines ce qui limite de façon importante,

D’autre part,

les techniques du génie génétique,

ont permis d’isoler dans l’ADN d’un virus (V),

un gène X qui code pour la synthèse d’une protéine capable d’arrêter le développement du champignon(R)

comment peut-on isoler un gène de structure

? 3°- Le découpage de l’ADN viral a donné des fragments parmi lesquels se trouve le gène X qu’on veut repérer à l’aide d’une sonde moléculaire

Le tableau suivant montre la structure partielle de la sonde ainsi que celles des fragments obtenus

Sonde moléculaire Fragments d’ADN viral

F1 F2 F3 F4

AUUCGUAAACGGUAACACUGG CTAGCATATAGGAAAGATCAATGG TAAAGGCCCAGTTTCGCC TAAGCATTTGGGATTGTGACCG UUUAACGAGGGACAAATCAAAG

Rappelez qu’est ce qu’une sonde moléculaire

? Quel est le principe de son utilisation

? Retrouvez à partir du tableau,

le fragment appartenant au gène X

Proposez une démarche expérimentale permettant d’utiliser le virus dans la lutte contre le champignon R

Génétique humaine

EXERCICE 1 : On connaît chez l’homme un couple d’allèle (A,

a) qui détermine la présence ou l’absence d’une anomalie héréditaire

L’arbre généalogique suivant est celui d’une famille dont certains membres sont atteints par cette anomalie :

Homme sain

Homme atteint

Femme atteinte

Femme saine

envisager et discuter chaque hypothèse

EXERCICE 2 :

L’arbre généalogique ci-dessous est celui d’une famille dont certains membres sont atteints d’une maladie héréditaire

Homme malade

Homme sain

Femme saine

on sait distinguer par analyse de l’ADN l’allèle normal de l’allèle muté responsable de la maladie

L’ADN du sujet n°2 montre seulement la présence de l’allèle normal

a- Quelle est l’hypothèse confirmée par ces résultats

? b- Déterminer les génotypes possibles des sujets 1,

EXERCICE 3 :

Un médecin a établi l’arbre généalogique suivant faisant apparaître une tare,

la myopathie de Duchenne caractérisée par la dégénérescence des muscles conduisant à la mort généralement avant la puberté

Laquelle des deux hypothèses vous paraît la plus probable

Ecrire alors les génotypes possibles des individus 4,

9 et 10

? Ecrire alors leur génotype et celui de leurs parents

EXERCICE 4 :

Le document suivant représente une partie d’un arbre généalogique d’une famille dont certains de ses membres sont atteints d’une maladie héréditaire

Envisager et discuter toutes les hypothèses

on a pu déterminer le nombre d’allèles mutés et normaux chez les différents individus de l’arbre généalogique cidessus,

désignés arbitrairement par les lettres A,

Les résultats obtenus sont portés par le tableau suivant : Indivi dus

Nombre d’allèles

laquelle des hypothèses proposées dans la réponse à la question précédente est confirmée par ces résultats

? b- Compléter le tableau suivant : individus

Génotype Numéro de l’individu

EXERCICE 5 non corrigé: La drépanocytose est une maladie héréditaire grave caractérisée par la présence d’une β-globine anormale provoquant une déformation des hématies

L’arbre généalogique du document 1 est celui d’un couple (Mme et Mr X) qui a une fille malade et attend un 2ème enfant

? Document 1 1°- Expliquez en justifiant votre réponse,

le mode de transmission de cette maladie (dominance et localisation chromosomique) 2°- A partir de l’analyse de l’ADN fœtal prélevé des villosités choriales,

une technique appropriée permet d’obtenir un grand nombre de copies du gène de la β-globine

Ces copies sont séparées en deux lots dont chacun est mis en présence d’une sonde moléculaire radioactive

a- Définir qu’est ce qu’une sonde moléculaire puis expliquer brièvement son principe d’utilisation pour le repérage des gènes

b- De l’ADN prélevé chez Mme et Mr X ainsi que leur fille est soumis à un traitement par deux sondes moléculaires puis à une autoradiographie

Les résultats sont figurés par le document2 Mr X Mme X Fille Foetus Sonde n°1

Document 2

Sonde n°2

D’un autre coté,

le document 3 présente les séquences nucléotidiques partielles des allèles HBa et Hbs du gène de la β-globine (brins non transcrits) ainsi que les séquences complètes des 2 sondes moléculaires radioactives utilisées

Séquences partielles des nucléotides des allèles HBa et HBs du gène de la β-globine (brins non transcrits)

Position 1 10 20 30 40 des nucléotides HBa ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCC

HBs ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCC Séquences complètes (19 nucléotides) des deux sondes radioactives utilisées : Sonde n°1 : GAGGACACCTCTTCAGACG Sonde n°2 : GAGGACTCCTCTTCAGACG

Document 3 A de l’analyse des documents 2 et 3 et de vos propres connaissances : a- Faites une correspondance entre chaque sonde et l’allèle qui lui convient

b- En déduire les génotypes de Mr et Mme X ainsi que ceux de leur fille et du foetus attendu

EXERCICE 6 non corrigé: On sait que les daltoniens confondent entre certaines couleurs,

en particulier le rouge et le vert

Pierre est affecté de cette anomalie ainsi que certains membres de sa famille

Alors que la mère et l’une des sœurs de Pierre ne présente pas cette anomalie,

le père et l’autre sœur de Pierre en sont atteints

Cette dernière a 3enfants : 2 garçons atteints de daltonisme et une fille non daltonienne

Pierre lui-même a 2 garçons et 2 filles non daltoniens

En revanche le frère de la mère de Pierre est atteint de cette anomalie

en représentant un homme par un carré et une femme par un cercle

Les individus atteints de daltonismes seront figurés en noir

retrouver les génotypes du père,

de la mère et des sœurs de Pierre

Expliquer les raisons qui vous conduisent à leur attribuer ces génotypes

les génotypes des enfants et de la femme de Pierre

les génotypes des enfants et du mari de la sœur de Pierre

EXERCICE 7 non corrigé: L’arbre généalogique suivant est celui d’une famille dont certains membres sont atteints d’une anomalie héréditaire

Femme saine

Femme atteinte 1

Homme atteint

Homme sain 1

? Discuter les hypothèses possibles en se basant sur des arguments

que peut-on préciser sur le mode de transmission de cette anomalie

? 4- Ecrire les génotypes possibles des membres de cette famille

EXERCICE 8 non corrigé: Dans une population humaine,

l’étude de la transmission d’une maladie héréditaire donnée est basée sur l’analyse généalogique

On rencontre les trois situations suivantes :

Homme normal

Homme malade

Femme malade

Femme normale

EXERCICE 9 non corrigé: L’arbre généalogique suivant montre la transmission d’une anomalie héréditaire chez une famille :

Homme sain

Homme atteint 1

Femme saine

Femme atteinte

? Justifier les hypothèses possibles

quelle hypothèse peut-on alors confirmer

? 4- Ecrire les génotypes possibles de cette famille

EXERCICE 10 non corrigé: La mucoviscidose est une maladie héréditaire grave associant des troubles digestifs et respiratoires

L’arbre généalogique suivant est celui d’une famille dont certains de ses membres sont atteints de cette maladie:

Femme saine 1

Fœtus 1- L’allèle responsable de cette maladie est-il dominant ou récessif

I2 II2 II3 III1 etIII3

Laquelle

Correction

Première partie :  Fonction de reproduction chez l’homme  Fonction de reproduction chez la femme

EXERCICE 1 : QCM

4-: b-d

8-: b- c'

13-: a-c

17-: a-b

23-: b-d

26-: b-c

28-:a-c

30-: a- c

EXERCICE 2 : Stimulations (Internes et externes)

HYPOTHALAMUS Pulse de Gn-RH

HYPOPHYSE ANTERIEUR

TESTICULE Cellules de LEYDIG (Tissu interstitiel)

Tubes séminifères Cellules de Sertoli

TESTOSTERONE

Cellules germinales

INHIBINE

Développement des caractères sexuels secondaires masculins Développement du tractus génital

Schéma fonctionnel du mécanisme de régulation et de contrôle des fonctions testiculaires

1°a- Le document 1 représente une portion de coupe dans un ovaire d’une femme pubère

Légende du document1 : 1- Follicule primordial A- Ovocyte I 2- Follicule primaire B- Thèque externe 3- Follicule cavitaire C- Thèque interne 4- Follicule dominant D- Granulosa ou de DEGRAAF E- Antrum b- La coupe d’ovaire a été réalisée à l’age de la puberté pendant la phase folliculaire du cycle ovarien (présence de follicules en évolution)

Ovocyte I (doc1) Cellule diploïde (2n=46) mais bloquée en prophase I Cytologiques Absence de globules polaire

Ovocyte I (doc2) Cellule haploïde (n=23) mais bloquée en métaphase II Présence du 1er globule polaire

3°- Anaphase I et Anaphase II d’une cellule à 2n= 4chromosomes

EXERCICE 4 :

A1°- Légende : 1- spermatogonie 6- cellule de Sertoli 2- spermatocyte I 7- membrane basale 3- spermatocyte II 8- capillaire sanguin 4- spermatide 9- cellules de Leydig (tissu interstitiel) 5- spermatozoïde 10- tube séminifère 2°- la région A représente la périphérie d’un tube séminifère qui est le siège de la spermatogenèse (fonction exocrine du testicule) La région B représente le tissu interstitiel qui secrète l’hormone sexuelle mâle (Testostérone),

cette région est responsable de la fonction endocrine du testicule

b et c'présentent une image d’anaphase puisque les chromosomes sont en ascension polaire

Il existe deux lots de chromosomes aux deux pôles de la cellule

4°- a- L’expérience proposée pour montrer le rôle de la région A : On détruit sélectivement par irradiation le tissu interstitiel chez un animal pubère

Cet animal montre une régression des caractères sexuels primaires (tractus génital) et des caractères sexuels secondaires

b- Pour montrer le mode d’action du tissu interstitiel,

on procède par des injections répétées d’extraits testiculaires à un animal pubère dont on a détruit auparavant ce tissu,

les caractères sexuels Iaires et IIaires réapparaissent de nouveau

EXERCICE 5 :

Remarques: On n’a représenté que les produits d’un seul pronucleus

Un même raisonnement (avec numérotation différente des chromosomes) permet de retrouver toujours 4 types de gamètes possibles selon deux possibilités de ségrégation

n=2 donc le nombre total de combinaisons = 22 x 22 = 4 x 4 = 16 combinaisons

EXERCICE 6:

1°- les figures du doc

La fécondation est la rencontre des 2 gamètes mâle et femelle puis la fusion de leurs matériaux nucléaires haploïdes (n) pour aboutir à la formation d’une cellule œuf ou zygote diploïde (2n) 2°- Légende : 1- Cellule folliculaire (corona radiata) 2- Spermatozoïde 3-Cellule issue de la 1ère mitose 4- Pronucléus mâle 5- Pronucléus femelle 3°- Titres des schémas : Pénétration du spermatozoïde Stade de 2 cellules Fusion des 2 pronucleï (caryogamie) Formation de 2 pronucleï mâle et femelle Anaphase de la 1ère mitose de la cellule œuf Rencontre des gamètes 4°- Ordre chronologique : F

L’éclatement de l’acrosome (réaction acrosomale) libère un contenu riche en enzymes qui entraînent la liquéfaction de la zone pellucide

La pénétration du 1er spermatozoïde déclenche la réaction corticale : éclatement des granules corticaux et déversement de leur contenu riche en enzymes dans l’espace péri ovocytaire

Ces enzymes détruisent les récepteurs protéiques de la zone pellucide ce qui empêche la fixation et la pénétration d’autres spermatozoïdes : c’est la monospermie

EXERCICE 7 : 43

1ère série d’expériences : 1° Expériences 1 et 2 : La sécrétion des gonadotrophines (FSH et LH) est sous la dépendance des neurones hypothalamiques  Expérience 3 : le contrôle hypothalamique sur la sécrétion des gonadotrophines hypophysaires (FSH et LH) est exercé par l’intermédiaire d’une neurohormone (Gn-RH) dont la sécrétion est discontinue (ou pulsatile)

la sécrétion des gonadostimulines hypophysaires (FSH et LH),

à travers la libération d’une neurohormone (La Gn-RH) et par là,

il commande de façon indirecte les fonctions ovariennes

ml-1) alors que le taux de LH augmente (25ng

ml-1) Les ovaires exercent un rétrocontrôle négatif (Rc-) sur la sécrétion de LH

A t1 : L’injection d’une faible dose d’oestradiol (≤60 pg

ml-1) est accompagnée d’une baisse du taux sanguin de LH qui diminue jusqu’à 3ng

à faible dose,

un rétrocontrôle négatif sur la libération de LH dans le sang(cas semblable à celui du Rc- au début de la phase folliculaire)

A t2 : l’injection d’une forte dose d’oestradiol (≥ 300 pg

importante (ou pic) de LH (› 30 ng

à forte dose,

par Rc+ sur la sécrétion de LH (cas similaire à celui de la décharge pré ovulatoire) A t3 : L’injection d’une faible dose d’oestradiol et de progestérone entraîne une chute du taux sanguin de LH L’oestradiol et la progestérone exercent un Rc- sur la sécrétion de LH (cas du Rc- au cours de la phase lutéale) 2°- La contraception hormonale est basée sur l’utilisation des hormones de synthèse (oestrogènes et progestérone de synthèse)

Dans le cas de la pilule combinée,

le mélange d’oestradiol et de progestérone administré chez la femme dès le début de son cycle sexuel,

exerce un Rc- sur le complexe hypothalamo hypophysaire (4ème expérience)

Ce rétrocontrôle a pour effet le maintien d’un taux faible de LH et empêche sa décharge (pic) pré ovulatoire à l’origine du phénomène de l’ovulation qui se trouve alors bloquée

3°- Schéma fonctionnel du déterminisme hormonal du cycle sexuel à la veille de l’ovulation

HYPOTHALA MUS Gn-RH

HYPOPHY SE FSH

FOLLICULE DOMINANT Oestrogènes UTERU

Prolifération de l’endomètre Contraction du myomètre Perméabilité de la glaire cervicale

EXERCICE 8:

Expérience 1 : Les ovaires sont indispensables au maintien de la grossesse durant les 3 premiers mois seulement Expérience 2 : la HCG est une hormone nécessaire au maintien du corps jaune et donc de la sécrétion des hormones ovariennes : oestrogènes et progestérone

Ces deux hormones sont indispensables au maintien de la dentelle utérine et donc de la grossesse

La HCG est secrétée dès la 2ème semaine de la fécondation par le blastocyste pour maintenir le corps jaune

Le taux de cette hormone atteint un pic vers la 8ème semaine puis décroît

Vers la 11ème semaine,

le placenta se forme et commence à secréter des oestrogènes et de la progestérone pour maintenir la grossesse ce qui signifie que le corps jaune n’est plus indispensable

EXERCICE 9 : 1) – Structures ovariennes produisant l’oestradiol

L’oestrogène stimule la contraction de myomètre

EXERCICE 10 :

1°- Analyse comparative de figures : Figures Hormones LH

Oestradiol

Progestérone

Figure A (Femme sans pilules)

Figure B (femme sous pilules)

Variation cyclique avec un pic important vers le milieu du cycle Variation cyclique avec en particulier 2 pics (le 1er vers le 12ème jour et le 2èmr vers le 21ème jour)

Taux faible et constant (absence de pic) Sécrétion faible et constante

Absente pendant la 1ère phase du cycle (1er au 14ème jour) et importante pendant la 2ème phase (15ème au 28ème jour) avec notamment un pic vers le 21ème jour

Sécrétion faible et constante

2°Chez la femme qui ne prend pas de pilules (Fig

A) : Taux élevé d’oestradiol (pic) Rétrocontrôle positif sur le complexe Hypothalamo-hpophysaire

Pic (ou décharge) de LH

OVULATION Chez la femme sous pilules contraceptives : Progestatifs de synthèse (pilule combinée)

Rétrocontrôle négatif sur le

complexe hypothalamo-Hypophysaire

Absence de pic de LH

Blocage de l’ovulation

EXERCICE 11 :

1°- Représentation schématique de l’anaphase I et L’anaphase II au cours de la gamétogenèse

Cellule mâle :

Ce llu le feme ll e :

2°- Tableau de la rencontre des gamètes et formation des zygotes Gamètes melles

Gamètes mâles

2 X’ 1X

1 Y 2 X

2 X’ 1 Y

1 X’ 1 Y

2 X 1 Y

2 X’ 2 X

3°-Pour les gamètes : 2n = 8 d’où n=4

Le nombre de gamètes possibles est 2 n = 2 4 = 16 Nombre de zygotes possibles = 2nx 2n = 24 x 24 = 16 x16 = 256 4°- Déduction : La méiose par le biais du brassage inter chromosomique permet la formation de gamètes génétiquement différents

La fécondation assure la rencontre au hasard des gamètes ce qui permet la formation de zygotes génétiquement différents

Donc la méiose et la fécondation ensemble assurent la diversité génétique et par conséquent une diversité morphologique des êtres vivants (ou polymorphisme)

Deuxième partie : 50

Génétique des diploïdes Génétique moléculaire Génétique humaine

EXERCICE 1: QCM

2-:a- c'

4-: a- b

6-:a- b

8-: c- d

9-: a- d

13-: a- b

14-: a- c'

15-: a- c

EXERCICE 2:

A- Les 2 parents diffèrent par 2 caractères héréditaires : « taille des ailes » et « couleur du corps » Il s’agit donc d’un dihybridisme

La F1 est homogène : tous les individus sont aux ailes longues et aux corps gris (1ère loi de Mendel vérifiée)

Les parents sont alors de races pures

Etant donné que les phénotypes des descendants des deux croisements ne dépendent pas de leurs sexes,

il s’agit d’un dihybridisme autosomique

Donc chaque caractère est contrôlé par un couple d’allèles : (vg+,

vg) contrôle la taille des ailes : vg+ ailes longues vg ailes vestigiales

e) contrôle la couleur du corps : e+ corps gris e corps ébène e+ > e Le 2ème croisement est un test cross (F1 x double récessif) qui a fourni 4 phénotypes différents (2 parentaux et 2 recombinés) et avec des proportions équiprobables de 1 / 4 (2003 / 4 = 500,

) Ces proportions correspondent à celles d’un test cross dans le cas de deux gènes autosomiques indépendants

Hypothèse : Les deux caractères sont contrôlés par 2 gènes autosomiques indépendants avec une relation de dominance absolue entre les allèles (vg+ > vg) et (e+ > e) avec intervention d’un brassage inter chromosomique

Vérification de l’Hypothèse: 1er croisement : Parents : P1 [ vg+,e+] X P2 [vg,

Gamètes

100 % vg+

100 % vg

Fécondation F1 :

vg 2ème croisement = test cross F1 + + [vg ,e ]

P2 [ vg ,e ]

Le parent P2 est un homozygote récessif,

il ne peut fournir qu’un seul type de gamètes vg e ce qui signifie que les phénotypes obtenus correspondent aux différents types de gamètes produits par l’hybride F1 par brassage inter chromosomique (ségrégation indépendante des 2 couples d’allèles 2ème loi de Mendel) Les gamètes de l’hybride F1 : 25 % vg+ e+ 25 % vg e 25 % vg+ e 25 % vg e+ Echiquier de croisement: Gamètes de F1 Gamètes P2

Les résultats obtenus dans le cadre de l’hypothèse sont conformes aux résultats de l’expérience L’hypothèse est alors vérifiée

B1°- Les deux parents diffèrent par deux caractères : La taille des ailes et la couleur des yeux cas de dihybridisme

F1 est homogène et tous les individus sont de mêmes phénotypes (ailes longues et yeux normaux) 1ère loi de Mendel vérifiée,

on peut alors déduire : La taille des ailes est gouvernée par un couple d’allèles (vg+,

vg) La couleur des yeux est contrôlée par un couple d’allèles (pr+,

pr) Avec : vg+> vg et pr+> pr Le 2ème croisement est un test cross (F1 x P2)

Si on suppose que les 2 gènes sont indépendants,

on devrait s’attendre aux résultats théoriques d’un test cross c

d 50 % de phénotypes parentaux et 50 % de phénotypes recombinés Or les résultats expérimentaux sont les suivants : % [ ] parentaux = 1339 + 1195 x 100 = 89

d par un brassage intra chromosomique qui s’est produit au cours de la méiose entraînant la recombinaison des allèles

Hypothèse : Les deux gènes sont liés (portés par la même paire de chromosomes) avec le déroulement d’un brassage intra chromosomique

Vérification de l’hypothèse :

Phénotype Génotype

Gamètes

P1 [vg pr+ ]

P2 [ vg pr ]

Test-cross:

P2 [ vg pr ]

Brassage intra chromosomique

Gamètes :

Echiquier de croisement :(résultats théoriques) Gamètes de F1 vg+ pr+ vg pr Gamètes de